View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1295_high_32 (Length: 260)
Name: NF1295_high_32
Description: NF1295
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1295_high_32 |
 |  |
|
| [»] chr3 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 223; Significance: 1e-123; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 30 - 260
Target Start/End: Complemental strand, 49445738 - 49445508
Alignment:
| Q |
30 |
gtatcgccctcatgaaaagattcccatctttcataatttggcccacttgaagcttctctctctcaactataactggaagctgttagtacatgtgttgtgt |
129 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49445738 |
gtatcgccctcatgacgagattcccatctttcataatttggcccacttgaagcttctctctctcaactataactggaagctgttagtacatgtgttgtgt |
49445639 |
T |
 |
| Q |
130 |
cactgcccaaagcttcaaaaacttgaccttagtgaggtttgtttagtttagggattgtatgtgatttattatttcctaagatgcctttgtggtttgttta |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49445638 |
cactgcccaaagcttcaaaaacttgaccttagtgaggtttgtttagtttagggattgtatgtgatttattatttcctaagatgcctttgtggtttgttta |
49445539 |
T |
 |
| Q |
230 |
attttattttatcattattaataggccaccg |
260 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
49445538 |
attttattttatcattattaataggccaccg |
49445508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 142 - 236
Target Start/End: Original strand, 49415800 - 49415894
Alignment:
| Q |
142 |
cttcaaaaacttgaccttagtgaggtttgtttagtttagggattgtatgtgatttattatttcctaagatgcctttgtggtttgtttaattttat |
236 |
Q |
| |
|
|||||||| |||| |||||||||||||||| ||||||||| | ||| |||||||| ||||| ||| ||||||||||| ||| ||| ||||||| |
|
|
| T |
49415800 |
cttcaaaatgttgagcttagtgaggtttgttaagtttaggggtcatatctgatttatcatttcttaacatgcctttgtgatttattttattttat |
49415894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University