View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1295_high_33 (Length: 251)

Name: NF1295_high_33
Description: NF1295
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1295_high_33
NF1295_high_33
[»] chr8 (1 HSPs)
chr8 (29-251)||(40280813-40281035)
[»] chr3 (1 HSPs)
chr3 (79-186)||(45129023-45129130)
[»] chr7 (1 HSPs)
chr7 (92-186)||(6632252-6632346)
[»] chr1 (1 HSPs)
chr1 (80-162)||(46131983-46132065)


Alignment Details
Target: chr8 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 29 - 251
Target Start/End: Complemental strand, 40281035 - 40280813
Alignment:
29 actgactgcaggaatccaaagacattgctaatgttgacgcggtctcttttattgcagttgggaaatccacttctagaatatgccactgacttcaattcaa 128  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40281035 actgactgcaggaatccaaagacattgctaatgttgacgcggtctcttttattgcagttgggaaatccacttctagaatatgccactgacttcaattcaa 40280936  T
129 gggctgagttcttctggtctcatggattgatatcagattcaacttacaaaatgttcaccgcaggctgcaattattcgcagtatgtaagtgagtactatag 228  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40280935 gggctgagttcttctggtctcatggattgatatcagattcaacttacaaaatgttcaccgcaggctgcaattattcgcagtatgtaagtgagtactatag 40280836  T
229 aaactccatttccctgctttgtt 251  Q
    |||||||||||||||||||||||    
40280835 aaactccatttccctgctttgtt 40280813  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 68; Significance: 2e-30; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 79 - 186
Target Start/End: Complemental strand, 45129130 - 45129023
Alignment:
79 attgcagttgggaaatccacttctagaatatgccactgacttcaattcaagggctgagttcttctggtctcatggattgatatcagattcaacttacaaa 178  Q
    ||||||||||||||||||| ||||||||||||| ||||| ||||||||||||||||| ||||| ||||| |||||| | ||||||||| ||||||||||     
45129130 attgcagttgggaaatccagttctagaatatgcaactgatttcaattcaagggctgaattcttttggtcacatggactaatatcagatgcaacttacaac 45129031  T
179 atgttcac 186  Q
    ||||||||    
45129030 atgttcac 45129023  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 92 - 186
Target Start/End: Complemental strand, 6632346 - 6632252
Alignment:
92 aatccacttctagaatatgccactgacttcaattcaagggctgagttcttctggtctcatggattgatatcagattcaacttacaaaatgttcac 186  Q
    |||||| || |||||| ||| || || || |||||||| ||||||||||| ||||||||||||||||| ||||| | ||| |  |||||||||||    
6632346 aatccagttttagaatttgcaacagattttaattcaagagctgagttcttttggtctcatggattgatctcagacttaacatttaaaatgttcac 6632252  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 80 - 162
Target Start/End: Original strand, 46131983 - 46132065
Alignment:
80 ttgcagttgggaaatccacttctagaatatgccactgacttcaattcaagggctgagttcttctggtctcatggattgatatc 162  Q
    |||||| |||| ||||| ||||| |||| | ||||||| | |||||| |||||||| || || ||||| ||||||||||||||    
46131983 ttgcagatgggcaatcctcttctggaatttaccactgattacaattccagggctgaatttttatggtcccatggattgatatc 46132065  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University