View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1295_high_45 (Length: 215)
Name: NF1295_high_45
Description: NF1295
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1295_high_45 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 133; Significance: 2e-69; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 133; E-Value: 2e-69
Query Start/End: Original strand, 1 - 145
Target Start/End: Complemental strand, 5921024 - 5920880
Alignment:
| Q |
1 |
gtttagagaatttaaactccgtctcttaaagctatatgatcaagttcttaacccatagctgaaatcttatagacatttgtcattatcaaaattaaaaata |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
5921024 |
gtttagagaatttaaactccgtctcttaaagctatatgatcaagttcttaacccatagctgaaatcttatagacatttgtcattatcaaaattcaaaatg |
5920925 |
T |
 |
| Q |
101 |
tttcactcaatgctaggaaacaccagtactttaccagtataatct |
145 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
5920924 |
tttcactcaatgctaggaaacaccagtactttaccaatataatct |
5920880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 102 - 135
Target Start/End: Complemental strand, 16677171 - 16677138
Alignment:
| Q |
102 |
ttcactcaatgctaggaaacaccagtactttacc |
135 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| |
|
|
| T |
16677171 |
ttcactcaatgctaggaaacaccagtaatttacc |
16677138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 102 - 142
Target Start/End: Complemental strand, 42456983 - 42456943
Alignment:
| Q |
102 |
ttcactcaatgctaggaaacaccagtactttaccagtataa |
142 |
Q |
| |
|
|||||| |||||||||||||||||||| ||||||| ||||| |
|
|
| T |
42456983 |
ttcacttaatgctaggaaacaccagtaatttaccaatataa |
42456943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 102 - 142
Target Start/End: Original strand, 12037306 - 12037346
Alignment:
| Q |
102 |
ttcactcaatgctaggaaacaccagtactttaccagtataa |
142 |
Q |
| |
|
||||||||||||||||||||||||||| |||| || ||||| |
|
|
| T |
12037306 |
ttcactcaatgctaggaaacaccagtaatttatcaatataa |
12037346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University