View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1295_high_46 (Length: 215)

Name: NF1295_high_46
Description: NF1295
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1295_high_46
NF1295_high_46
[»] chr8 (1 HSPs)
chr8 (1-123)||(5921000-5921121)


Alignment Details
Target: chr8 (Bit Score: 90; Significance: 1e-43; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 1 - 123
Target Start/End: Original strand, 5921000 - 5921121
Alignment:
1 gagacggagtttaaattctctaaacagttgcgaaataatcaataatgtcacttaattaatattaatttctattctccnnnnnnnnttatttaagaaagtg 100  Q
    ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||        |||||||||||||||    
5921000 gagacggagtttaaattctctaaacagttgctaaataatcaataatgtcacttaattaatattaatttctattctcc-aaaaaaattatttaagaaagtg 5921098  T
101 ttaacgattccatgtaaagaaaa 123  Q
    |||||||||||||||||||||||    
5921099 ttaacgattccatgtaaagaaaa 5921121  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University