View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1295_high_47 (Length: 210)
Name: NF1295_high_47
Description: NF1295
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1295_high_47 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 109; Significance: 5e-55; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 109; E-Value: 5e-55
Query Start/End: Original strand, 1 - 129
Target Start/End: Complemental strand, 13500730 - 13500602
Alignment:
| Q |
1 |
gagatttatcaccacttgccaatgaaacacgtgaggttcttgaaagaatgatgaagaacatctatggattaagcagggtggtagcgttaatgggtctagt |
100 |
Q |
| |
|
|||||||||||||||| || |||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
13500730 |
gagatttatcaccactagcaaatgaaacacgtgaggttctagaaagaatgatgaagaacatatatggattaagcagggttgtagcgttaatgggtctagt |
13500631 |
T |
 |
| Q |
101 |
tcagcttggtgttggaggatggatcacat |
129 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
13500630 |
tcagcttggtgttggaggatggatcacat |
13500602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University