View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1295_high_48 (Length: 210)
Name: NF1295_high_48
Description: NF1295
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1295_high_48 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 117; Significance: 9e-60; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 117; E-Value: 9e-60
Query Start/End: Original strand, 1 - 133
Target Start/End: Original strand, 13500706 - 13500838
Alignment:
| Q |
1 |
tcattggcaagtggtgataaatctctttccactgttggtccttcaatttcttggtgcttgaaatttgggttttcacctgggtatgggcttgagtctttct |
100 |
Q |
| |
|
||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
13500706 |
tcatttgctagtggtgataaatctctttccactgttggtccttcaatttcttggtgcttgaaatttggattttcacttgggtatgggcttgagtctttct |
13500805 |
T |
 |
| Q |
101 |
ctttctctttctcagaatcagatgatgatgatg |
133 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
13500806 |
ctttctctttctcagaatcagatgatgatgatg |
13500838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University