View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1295_low_22 (Length: 401)
Name: NF1295_low_22
Description: NF1295
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1295_low_22 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 116; Significance: 7e-59; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 116; E-Value: 7e-59
Query Start/End: Original strand, 184 - 303
Target Start/End: Complemental strand, 6921378 - 6921259
Alignment:
| Q |
184 |
gatatatatgagggaactcaaagattgagctgagatggggttgggatttgaggattcaaatgagtttatagaaagggagggtttgttgggttgtgtaaag |
283 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6921378 |
gatatatatgggggaactcaaagattgagctgagatggggttgggatttgaggattcaaatgagtttatagaaagggagggtttgttgggttgtgtaaag |
6921279 |
T |
|
| Q |
284 |
gaagagggggaagatcaaac |
303 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
6921278 |
gaagagggggaagatcaaac |
6921259 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 51; Significance: 4e-20; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 92 - 181
Target Start/End: Complemental strand, 43616603 - 43616513
Alignment:
| Q |
92 |
tgagatgaatggagaaagttttagaaacaaatagacaaatagttggtgggtgaaaaagaagtgatttgaaaatatgg-tttgtgtggatat |
181 |
Q |
| |
|
|||||||| |||||||||||||||||||||| ||| |||||||||||||||||||| | ||||| | ||||||||| ||||||||||||| |
|
|
| T |
43616603 |
tgagatgagtggagaaagttttagaaacaaaaagataaatagttggtgggtgaaaaccatgtgatctaaaaatatggatttgtgtggatat |
43616513 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University