View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1295_low_28 (Length: 335)
Name: NF1295_low_28
Description: NF1295
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1295_low_28 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 28 - 335
Target Start/End: Complemental strand, 34351454 - 34351147
Alignment:
| Q |
28 |
catgttcttgtgtaaaaggatagtaaaaaccacattcttttaattccaatcaatttctgcannnnnnnnnnaatctatatattaagttatcgaagacaaa |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||| |||||||||||||||||||||| |
|
|
| T |
34351454 |
catgttcttgtgtaaaaggatagtaaaaaccacattcttttaattccaatcaatttctacattttttttttaatctacatattaagttatcgaagacaaa |
34351355 |
T |
|
| Q |
128 |
tttgtttgaggatgagagaacaacaaggatgcaacttcttttaagaaattatgttttgcaaataatggatcattgttcccttcgtgttggtttgctcggg |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
34351354 |
tttgtttgaggatgagagaacaacaaggatgcaacttcttttaagaaattatgttttgaaaataatgtatcattgttcccttcgtgttggtttgctcggg |
34351255 |
T |
|
| Q |
228 |
tgagcatgtgtttggggttctcttgcactaagtggcttggggtgttgcctggtaggcgggagctctgttggtggtttgttttgatggcggttttttccca |
327 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
34351254 |
tgagcatgtgtttggggttctcttgcgctaagtggcttgaggtgttgcctggtaggcgggagctctgttggtggtttgttttggtggcggttttttccca |
34351155 |
T |
|
| Q |
328 |
tattttcc |
335 |
Q |
| |
|
|||||||| |
|
|
| T |
34351154 |
tattttcc |
34351147 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University