View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1295_low_36 (Length: 288)
Name: NF1295_low_36
Description: NF1295
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1295_low_36 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 11 - 271
Target Start/End: Original strand, 34478112 - 34478368
Alignment:
| Q |
11 |
agcagagaggagaagaagggagagaataaatggtcaccttggaacattacgtggtcttgtggcttccactcatcaaaaggtatgttttgttccttctttt |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34478112 |
agcagagaggagaagaagggagagaataaatggtcaccttggaacattacgtggtcttgtggcttccactcatcaaaaggtatgttttgttccttctttt |
34478211 |
T |
|
| Q |
111 |
tgttgtcagttttataatttcattctaattgtaagattggtttagaattttatcaatatattatatttgaaaagttatgattaattaaaatagcagattc |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
34478212 |
tgttgtcagttttataatttcattctaattgtaagattggtttagaattttatcaatatattatatttgaaaagttatg----attaaaatagcggattc |
34478307 |
T |
|
| Q |
211 |
ttgcgtaaaaagtaaacatatgcagcaccggcacttcatattgaaggtgatatgtggttac |
271 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
34478308 |
ttgcgtaaaaagtaaacatatgcagcaccggcacttcatattgaaggtggtatgtggttac |
34478368 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University