View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1295_low_45 (Length: 251)
Name: NF1295_low_45
Description: NF1295
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1295_low_45 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 44144517 - 44144738
Alignment:
| Q |
1 |
tgatgatgtaaactgaggcgatatccatttcgcaccgtatatacaccgtttttctcgtgattccaactcagtttataatggtggatagattctagattcg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44144517 |
tgatgatgtaaactgaggcgatatccatttcgcaccgaatatacaccgtttttctcgtgattccaactcagtttataatggtggatagattctagattcg |
44144616 |
T |
 |
| Q |
101 |
gtgttttcaggattttcgctgcatcttcggcattcacaagactccaaatgaaaccaacatcccataatctagtattctcaatcatcaaatctgcgacagt |
200 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44144617 |
gtgttttcaggatttttgctgcatcttcggcattcacaagactccaaatgaaaccaacatcccataatctagtattctcaatcatcaaatctgcgacagt |
44144716 |
T |
 |
| Q |
201 |
gaggtcttccaactcatgatac |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
44144717 |
gaggtcttccaactcatgatac |
44144738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University