View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1295_low_47 (Length: 251)
Name: NF1295_low_47
Description: NF1295
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1295_low_47 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 94; Significance: 5e-46; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 1 - 176
Target Start/End: Original strand, 13501286 - 13501462
Alignment:
| Q |
1 |
ttgtagccgtcaaactaagttatccgacccgtttatgatcagttctaatgagcttcaaactttacgaggtcgggccaaaatccttattaaaagacaagtt |
100 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||| ||| |||||||||||||| |||||||||||||||||||||| |||||||||||| |
|
|
| T |
13501286 |
ttgtagccgtcaaactaaattatccgacccgtttatgatcagtcttaacaagcttcaaactttatgaggtcgggccaaaatccttataaaaagacaagtt |
13501385 |
T |
 |
| Q |
101 |
at-nnnnnnnnnttatttgagctcggtcctatacaggtcacgaactaaacagattggcccgtataaaaaataacttt |
176 |
Q |
| |
|
|| |||||||||||| ||||||||| |||||||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
13501386 |
ataaaaaaaaaattatttgagctcagtcctatacgggtcacgaactaaacagaccggcccctataaaaaataacttt |
13501462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 198 - 238
Target Start/End: Original strand, 13501564 - 13501604
Alignment:
| Q |
198 |
aaactaaaatgacgaggaaatcaactttagataaattacct |
238 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
13501564 |
aaactaaaacgacgaggaaatcaactttagataaattacct |
13501604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University