View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1295_low_50 (Length: 250)
Name: NF1295_low_50
Description: NF1295
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1295_low_50 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 230; Significance: 1e-127; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 1 - 238
Target Start/End: Original strand, 24949697 - 24949934
Alignment:
| Q |
1 |
atctagataaccataagaaatggtttcatcagccttttaggcctgaatttgagcgatgtcaattactgcattaactaagaactaactaattacatgatac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24949697 |
atctagataaccataagaaatggtttcatcagccttttaggcctgaatttgagcgatgtcaattactgcattaactaagaactaactaattacatgatac |
24949796 |
T |
|
| Q |
101 |
ttcattattttgcataacctgcagtatattgaggagatagctataatgatatacagaatcagagtgaaaaatgaaatttaaaatcaaaagagaatggtaa |
200 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
24949797 |
ttcattactttgcataacctgcagtatattgaggagatagctataatgatatacagaatcagagagaaaaatgaaatttaaaatcaaaagagaatggtaa |
24949896 |
T |
|
| Q |
201 |
atgagttttaagatctcatcattgagctagaccagaat |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24949897 |
atgagttttaagatctcatcattgagctagaccagaat |
24949934 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 39 - 100
Target Start/End: Original strand, 24366741 - 24366802
Alignment:
| Q |
39 |
aggcctgaatttgagcgatgtcaattactgcattaactaagaactaactaattacatgatac |
100 |
Q |
| |
|
|||||||||| ||||| |||| ||||||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
24366741 |
aggcctgaatatgagcagtgtcgattactgcattaactaataactacctaattacatgatac |
24366802 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University