View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1295_low_55 (Length: 244)
Name: NF1295_low_55
Description: NF1295
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1295_low_55 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 109; Significance: 6e-55; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 1 - 125
Target Start/End: Complemental strand, 22045002 - 22044878
Alignment:
| Q |
1 |
atttactatgtatgtaaacttatctaacttataatcattattctacatggtacttttccctattttccatttggttcggtctgtacttctcaaagactta |
100 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
22045002 |
atttactatgtatgtaaacttagctaacttataatcattattctacatagtacttttccctattttccatttggttcggtctgtagttctcaaagactta |
22044903 |
T |
|
| Q |
101 |
taatatatacaaattctttagttta |
125 |
Q |
| |
|
||||||||||| ||||||||||||| |
|
|
| T |
22044902 |
taatatatacagattctttagttta |
22044878 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University