View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1295_low_61 (Length: 223)

Name: NF1295_low_61
Description: NF1295
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1295_low_61
NF1295_low_61
[»] chr1 (1 HSPs)
chr1 (155-223)||(50246552-50246620)


Alignment Details
Target: chr1 (Bit Score: 69; Significance: 4e-31; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 155 - 223
Target Start/End: Original strand, 50246552 - 50246620
Alignment:
155 ttctatatggtataggatcatcttgatgacaagtatgaatttgactccaattgggatcccaagaacaaa 223  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
50246552 ttctatatggtataggatcatcttgatgacaagtatgaatttgactccaattgggatcccaagaacaaa 50246620  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University