View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1295_low_62 (Length: 220)
Name: NF1295_low_62
Description: NF1295
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1295_low_62 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 101; Significance: 3e-50; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 1 - 122
Target Start/End: Complemental strand, 412250 - 412133
Alignment:
| Q |
1 |
ttaagactgaaatgaaaactctcactcacacacactaatataggccatgttctgcatgttgggacaaaagtacgtagttgttgaacttgaaggaaggaat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
412250 |
ttaagactgaaatgaaaactctcactcacacacactaatatagaccatgttctgcatgttgggacaaaagtacgtagttgttgaacttgaa----ggaat |
412155 |
T |
|
| Q |
101 |
gagacaaaacagttgggtgtag |
122 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
412154 |
gagacaaaacagttgggtgtag |
412133 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University