View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1295_low_67 (Length: 210)

Name: NF1295_low_67
Description: NF1295
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1295_low_67
NF1295_low_67
[»] chr8 (1 HSPs)
chr8 (1-133)||(13500706-13500838)


Alignment Details
Target: chr8 (Bit Score: 117; Significance: 9e-60; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 117; E-Value: 9e-60
Query Start/End: Original strand, 1 - 133
Target Start/End: Original strand, 13500706 - 13500838
Alignment:
1 tcattggcaagtggtgataaatctctttccactgttggtccttcaatttcttggtgcttgaaatttgggttttcacctgggtatgggcttgagtctttct 100  Q
    ||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||    
13500706 tcatttgctagtggtgataaatctctttccactgttggtccttcaatttcttggtgcttgaaatttggattttcacttgggtatgggcttgagtctttct 13500805  T
101 ctttctctttctcagaatcagatgatgatgatg 133  Q
    |||||||||||||||||||||||||||||||||    
13500806 ctttctctttctcagaatcagatgatgatgatg 13500838  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University