View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12960_low_4 (Length: 342)
Name: NF12960_low_4
Description: NF12960
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12960_low_4 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 306; Significance: 1e-172; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 306; E-Value: 1e-172
Query Start/End: Original strand, 12 - 321
Target Start/End: Original strand, 7755235 - 7755544
Alignment:
| Q |
12 |
atgaagcaatagtagcaccgtgaagccgaattgaagaggacccaatgcaacaatgaggacacaaaggaggacagaaacagaagaatctcgcatgacatat |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7755235 |
atgaagcaatagtagcaccgtgaagccgaattgaagaggacccaatgcaacaatgaggacacaaaggaggacagaaacagaagaatctcgcatgacatat |
7755334 |
T |
 |
| Q |
112 |
tgagttgaagagtttaagatattagtttgttttgatcccattctgtaccagctaccagtgttaagaaatggtttcttaaggttgtttccatcttcataat |
211 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7755335 |
tgagttgaagaatttaagatattagtttgttttgatcccattctgtaccagctaccagtgttaagaaatggtttcttaaggttgtttccatcttcataat |
7755434 |
T |
 |
| Q |
212 |
cttctctgatcaagctcattgcagcttcagaaacaaaacttcaaagttcaacaagagaggtaggtgtctctatcccttgttacttgtgatgtttgttgag |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7755435 |
cttctctgatcaagctcattgcagcttcagaaacaaaacttcaaagttcaacaagagaggtaggtgtctctatcccttgttacttgtgatgtttgttgag |
7755534 |
T |
 |
| Q |
312 |
acaaaagaca |
321 |
Q |
| |
|
|||||||||| |
|
|
| T |
7755535 |
acaaaagaca |
7755544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University