View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12960_low_7 (Length: 239)
Name: NF12960_low_7
Description: NF12960
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12960_low_7 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 47307563 - 47307784
Alignment:
| Q |
1 |
taccggtttgtaaaattacttaacttcagtttatgtt-ctgattatggacttctgtcacagaaattcctgggagttattgcaagaaattctttgtcactt |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47307563 |
taccggtttgtaaaattacttaacttcagtttatgtttctgattatggacttttgtcacagaaattcctgggagttattgcaagaaattctttgtcactt |
47307662 |
T |
|
| Q |
100 |
tcaagagataagaccggatgttgtgtgctgcagtattgtgttagccatgctgaaggagcaactaagaatcttctgattcatgaaataatacttcatgctc |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47307663 |
tcaagagataagaccggatgttgtgtgctgcagtattgtgttagccatgctcaaggagcaactaagaatcttctgattcatgaaataatacttcatgctc |
47307762 |
T |
|
| Q |
200 |
cactattagcagaagattgtta |
221 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
47307763 |
cactattagcagaagattgtta |
47307784 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University