View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12961_high_2 (Length: 388)
Name: NF12961_high_2
Description: NF12961
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12961_high_2 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 290; Significance: 1e-163; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 290; E-Value: 1e-163
Query Start/End: Original strand, 18 - 364
Target Start/End: Complemental strand, 2097137 - 2096780
Alignment:
| Q |
18 |
atgaaaactaatagtagtatgaagcatttattatgcttaacagacaacgtttaactaataacgtatctatatacaaatggcttgcatgcatg----aaca |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
2097137 |
atgaaaactaatagtagtatgaagcatttattatgcttaacagacagcgtttaactaataacgtatctatatacaaatggcttgcatgcatgcatgaaca |
2097038 |
T |
 |
| Q |
114 |
taatccgactttacagggtggaacccttctggcttgctctatacctcactcctcatgaataattatctaactatatttctgcaaacttctaaatatttca |
213 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
2097037 |
taatccgactttacagggtggaatccttctggcttgctctatacctcactcctcatgaataattatctaactatatttctgctaacttctaaatatttca |
2096938 |
T |
 |
| Q |
214 |
attcctgaattccctcgtcctatagttctttgcacatttaaagcactactacgtaaccacatcaaa--cacatagtatgactaagcaaacactaaatgtt |
311 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||| |
|
|
| T |
2096937 |
attcctgaattccctcgtcctatagttctttgcacattttaagcactactacgtaaccacatcaaacacacatggtatgactaagcaaacactaaatgtt |
2096838 |
T |
 |
| Q |
312 |
tagtacatat-----tggctggatgcatgttaaaatgaattctgcttgtgtgtcggtc |
364 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2096837 |
tagtacatatatatgtggctggatgcatgttaaaatgaattctgcttgtgtgtcggtc |
2096780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University