View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12961_high_8 (Length: 211)
Name: NF12961_high_8
Description: NF12961
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12961_high_8 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 70; Significance: 1e-31; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 18 - 100
Target Start/End: Complemental strand, 7935303 - 7935219
Alignment:
| Q |
18 |
cttttactccattcctcaaatttacatccac--gaaaccatggcttcttgtgcacactaacacacagtgacaacgtttgacagat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
7935303 |
cttttactccattcctcaaatttacatccacacgaaaccatggcttcttgtacacactaacacacagtgacaacgtttgacagat |
7935219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 92 - 151
Target Start/End: Complemental strand, 7932802 - 7932743
Alignment:
| Q |
92 |
ttgacagatagacagtgggaccatggtagtcaagtactttggggtaaccttagctaccac |
151 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7932802 |
ttgacagatagacagtgggaccatggtagtcaagtactttggggtaaccttagctaccac |
7932743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University