View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12961_low_11 (Length: 216)

Name: NF12961_low_11
Description: NF12961
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12961_low_11
NF12961_low_11
[»] chr5 (1 HSPs)
chr5 (15-199)||(40556296-40556480)


Alignment Details
Target: chr5 (Bit Score: 173; Significance: 3e-93; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 15 - 199
Target Start/End: Original strand, 40556296 - 40556480
Alignment:
15 aaaatacaaaactgatcgaggagaataaggaagaaaagtcactggagcttcaacatcgaaaatggaggaaagtgtttttgtttctagaatattgaatgaa 114  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40556296 aaaatacaaaactgatcgaggagaataaggaagaaaagtcactggagcttcaacatcgaaaatggaggaaagtgtttttgtttctagaatattgaatgaa 40556395  T
115 tatggtggtgatgattatcggatgatggaaaatttattatgtttgcgatctaagttcttagctaatcaattcaaagatgatgttt 199  Q
    |||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||| |||||||||    
40556396 tatggtggtgatgattatcggatgatggaaaatttactaagtttgcgatctaagttcttagctaatcaattcaaaaatgatgttt 40556480  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University