View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12961_low_12 (Length: 211)

Name: NF12961_low_12
Description: NF12961
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12961_low_12
NF12961_low_12
[»] chr8 (2 HSPs)
chr8 (18-100)||(7935219-7935303)
chr8 (92-151)||(7932743-7932802)


Alignment Details
Target: chr8 (Bit Score: 70; Significance: 1e-31; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 18 - 100
Target Start/End: Complemental strand, 7935303 - 7935219
Alignment:
18 cttttactccattcctcaaatttacatccac--gaaaccatggcttcttgtgcacactaacacacagtgacaacgtttgacagat 100  Q
    |||||||||||||||||||||||||||||||  |||||||||||||||||| |||||||||||||||||||||||||||||||||    
7935303 cttttactccattcctcaaatttacatccacacgaaaccatggcttcttgtacacactaacacacagtgacaacgtttgacagat 7935219  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 92 - 151
Target Start/End: Complemental strand, 7932802 - 7932743
Alignment:
92 ttgacagatagacagtgggaccatggtagtcaagtactttggggtaaccttagctaccac 151  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7932802 ttgacagatagacagtgggaccatggtagtcaagtactttggggtaaccttagctaccac 7932743  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University