View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12962_high_13 (Length: 250)
Name: NF12962_high_13
Description: NF12962
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12962_high_13 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 1 - 235
Target Start/End: Complemental strand, 40787319 - 40787085
Alignment:
| Q |
1 |
cgaccatgtgcctaggtagtctaggcaataattcaacgatcagttataactcaagtattctcccttattgggatatatcatcactttcgggtattattgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40787319 |
cgaccatgtgcctaggtagtctaggcaataattcaacgatcagttataactcaagtattctcccttattgggatatatcatcactttcgggtattattgt |
40787220 |
T |
|
| Q |
101 |
tggtcattcatatgtttaatttcttctagtaataatcttttacacaagaggatgaaccgtattgagtggggttgcatgttcaatctttggcttttggtag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40787219 |
tggtcattcatatgtttaatttcttctagtaataatcttttacacaagaggatgaaccgtattgagtggggttgcatgttcaatctttggcttttggtag |
40787120 |
T |
|
| Q |
201 |
tattgtattttagctatgatttacttgatgataat |
235 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| |
|
|
| T |
40787119 |
tattgtattttagctataatttacttgatgataat |
40787085 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University