View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12962_high_14 (Length: 222)
Name: NF12962_high_14
Description: NF12962
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12962_high_14 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 17 - 207
Target Start/End: Original strand, 16439239 - 16439429
Alignment:
| Q |
17 |
aagaaacgcgttagataacttctgtttgaagaaagttcattctgtatttagttaaggaatgattgataacttgctcgatacttggaatttgatctctttg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16439239 |
aagaaacgcgttagataacttctgtttgaagaaagttcattctgtatttagttaaggaatgattgataacttgctcgatacttggaatttgatctctttg |
16439338 |
T |
|
| Q |
117 |
tgtgtgtgtatgtgcatacgtcttccttttctaaataatcttagattttctaatttttacttctaatccctctgtgtgtatgcttgtgtat |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
16439339 |
tgtgtgtgtatgtgcatacgtcttccttttctaaataatcttagattttcaattttttacttctaatctctctgtgtgtatgcttgtgtat |
16439429 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 60; Significance: 9e-26; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 36 - 167
Target Start/End: Complemental strand, 24078274 - 24078143
Alignment:
| Q |
36 |
ttctgtttgaagaaagttcattctgtatttagttaaggaatgattgataacttgctcgatacttggaatttgatctctttgtgtgtgtgtatgtgcatac |
135 |
Q |
| |
|
|||||||||||||||||||| || ||||| ||||| |||| |||| | ||||||| ||| || |||||| |||||||| |||| ||||||| ||| || |
|
|
| T |
24078274 |
ttctgtttgaagaaagttcaatccatattttgttaaagaatcgttgacagcttgctcaatagttagaatttaatctctttatgtgcgtgtatgcgcacac |
24078175 |
T |
|
| Q |
136 |
gtcttccttttctaaataatcttagattttct |
167 |
Q |
| |
|
||||||||||||||||||||||||||| |||| |
|
|
| T |
24078174 |
gtcttccttttctaaataatcttagatgttct |
24078143 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University