View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12962_low_10 (Length: 363)
Name: NF12962_low_10
Description: NF12962
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12962_low_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 183; Significance: 6e-99; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 183; E-Value: 6e-99
Query Start/End: Original strand, 7 - 205
Target Start/End: Complemental strand, 1600372 - 1600174
Alignment:
| Q |
7 |
agaaagatagcagctccacctgattttcctttgagcgacgaaaataggaaattcttctctagtcatggatgccttcttgaatgaaccctgaaatgtaaga |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1600372 |
agaaagatagcagctccacctgattttcctttgagtgacgaaaataggaaattcttctcgagtcatggatgccttcttgaatgaaccctgaaatgtaaga |
1600273 |
T |
 |
| Q |
107 |
tgcttttttgttgagatttacttctgaaagaaattacttattgtttataagtctgtgcataataattgtgtaagttagtatttttgagatttaacttgt |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
1600272 |
tgcttttttgttgagatttacttctgaaagaaattacttattgtttataagtctgtgcataataattgcgtaagttaatatttttgagatttaacttgt |
1600174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 228 - 357
Target Start/End: Complemental strand, 1600191 - 1600073
Alignment:
| Q |
228 |
ttttgagatttaacttgtataatgcaaataaattttaattagtttttcattgttttgcccctgaattggataaaattcttgtgttatacttactaaattc |
327 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1600191 |
ttttgagatttaacttgtataatgcaaataaattttaattagttttgc-----------cctgaattggataaaattcttgtgttatacttactaaattc |
1600103 |
T |
 |
| Q |
328 |
ttgctgtaagacattattctccatagttgc |
357 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
1600102 |
ttgctgtaagacattattctccatagttgc |
1600073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 37; Significance: 0.000000000008; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 7 - 87
Target Start/End: Original strand, 38267814 - 38267894
Alignment:
| Q |
7 |
agaaagatagcagctccacctgattttcctttgagcgacgaaaataggaaattcttctctagtcatggatgccttcttgaa |
87 |
Q |
| |
|
||||||||||| |||||||||||||||||| || |||| |||||||| | |||||| |||||||||||||||||||| |
|
|
| T |
38267814 |
agaaagatagctgctccacctgattttcctacgaccgacagaaataggacactcttcttgcgtcatggatgccttcttgaa |
38267894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University