View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12962_low_4 (Length: 539)
Name: NF12962_low_4
Description: NF12962
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12962_low_4 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 286; Significance: 1e-160; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 286; E-Value: 1e-160
Query Start/End: Original strand, 230 - 523
Target Start/End: Original strand, 37734077 - 37734370
Alignment:
| Q |
230 |
ggtaccagcgctgaacaacaagaagaaagcgaaggtgacaatgacaatgaagaagatacggattacgattccgatgaggatgatgaggatgttgatggtg |
329 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
37734077 |
ggtaccagcgctgaacaacaagatgaaagcgaaggtgacaatgacaatgaagaagatacggattacgattccgatgaggatgatgatgatgttgatggtg |
37734176 |
T |
 |
| Q |
330 |
atgaggacggtgataatcaggttgtaccttggtcgtcaacggcggcgcagcctccaccggcttcgagttcctccggtagcgatgagtcggtttcggttag |
429 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37734177 |
atgaggacggtgataatcaggttgtaccttggtcgtcaacggcggcgcagcctccaccggcttcgagttcctccggtagcgatgagtcggtttcggttag |
37734276 |
T |
 |
| Q |
430 |
caagtgcaacgataaccacgatgaggttatttcgaagttagttacaacgatttctttgaaacgacgtcgtttggatcatgattttgaggtaatt |
523 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37734277 |
caagtgcaacgataaccacgatgaggttatttcgaagttagttacaacgatttctttgaaacgacgtcgtttggatcatgattttgaggtaatt |
37734370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 156; E-Value: 1e-82
Query Start/End: Original strand, 11 - 182
Target Start/End: Original strand, 37733876 - 37734047
Alignment:
| Q |
11 |
ttatactgggactgcgattctaaggtccacgctgctaactttttggttgagagacacatgagaactctcctctgtcacgcttgtcaatctccgacaccgt |
110 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||| |
|
|
| T |
37733876 |
ttatgctgggactgcgattctaaggtccacgctgctaactttttggttgagagacacatgagaactctcctctgtcacgcttgtcaatctcccacgccgt |
37733975 |
T |
 |
| Q |
111 |
ggaaagcctccggtgctaggctcggtaacgcgctttcgttgtgtgatagatgcgcgggcggaagaaaactcc |
182 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
37733976 |
ggaaagcctccggtgctaggctcggtaacgcgctttcgttgtgtgatagatgcgccggcggaagaaaactcc |
37734047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University