View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12963_high_10 (Length: 214)
Name: NF12963_high_10
Description: NF12963
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12963_high_10 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 120; Significance: 1e-61; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 120; E-Value: 1e-61
Query Start/End: Original strand, 1 - 193
Target Start/End: Complemental strand, 6088707 - 6088511
Alignment:
| Q |
1 |
caaatggagaaaccaatgaagatgctctcaagaggtaattaagattaaccagtagtgatggtacattttaattaccactcaaagtataattatgctacaa |
100 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||| || ||||| || ||||||||||||||||||||||| |||||||||| ||||| |
|
|
| T |
6088707 |
caaatggagaaaccaatgaagaagctctcaagaggtaattaagataaattagtagagacggtacattttaattaccactcaagttataattatgttacaa |
6088608 |
T |
|
| Q |
101 |
ttattgttacatagataa----catttttattctaatacattcaggttagcaaaaatactttcacaagagaggagacttagagaaatgagatcccca |
193 |
Q |
| |
|
||||| ||| || || | ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6088607 |
ttatttttatattaattaatgacatatttattctaatacattcaggttagcaaaaatactttcacaagagaggagacttagagaaatgagatcccca |
6088511 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University