View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12964_low_21 (Length: 233)
Name: NF12964_low_21
Description: NF12964
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12964_low_21 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 1 - 213
Target Start/End: Original strand, 40103733 - 40103944
Alignment:
| Q |
1 |
atgatattagttggtgtgactta-ttatttttgtctaattttgttgattttatgtgaacgtgttcaaataatattaatttagatatgtatctatcaaata |
99 |
Q |
| |
|
||||||| ||||||||||||| | ||||| |||||||||||||||||||| |||| ||||||| |||||||||||||||||| |||||||||||||| || |
|
|
| T |
40103733 |
atgatatcagttggtgtgactgaattattgttgtctaattttgttgatttcatgtcaacgtgtccaaataatattaatttaggtatgtatctatcaacta |
40103832 |
T |
 |
| Q |
100 |
ctttctcgaatattaaagacaaagaacacacatatataatactaacgtggtggggtggggacgatatcaacactcgagctcgactttaaataatcaagta |
199 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||| |||| ||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
40103833 |
ctttctcgaatattaaagacaaaga--acacatatataatactaacatggtagggtggggacgatatcaacactcgacctcgactttaaataatcaagta |
40103930 |
T |
 |
| Q |
200 |
aaacccacacacac |
213 |
Q |
| |
|
|||| ||||||||| |
|
|
| T |
40103931 |
aaactcacacacac |
40103944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University