View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12965_high_20 (Length: 355)
Name: NF12965_high_20
Description: NF12965
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12965_high_20 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 72; Significance: 1e-32; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 112 - 249
Target Start/End: Original strand, 185017 - 185151
Alignment:
| Q |
112 |
ttatttgaatattgatttcaattatgttattccaatgtaacgtaactatgataattaagtttnnnnnnn--taatggtaagtattggttaaaataaatgt |
209 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
185017 |
ttatttgaatattgctttcaattatgttattccaatgtaac-----tatgataattaagtttaaaaaaaaataatggtaagtattggttaaaataaatgt |
185111 |
T |
|
| Q |
210 |
tgtatttaatagagtaatcaagtgtcacccaacacctcac |
249 |
Q |
| |
|
|||||||||||||| ||| |||||||||||| |||||||| |
|
|
| T |
185112 |
tgtatttaatagagaaatgaagtgtcacccaccacctcac |
185151 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University