View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12965_low_9 (Length: 543)
Name: NF12965_low_9
Description: NF12965
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12965_low_9 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 348; Significance: 0; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 348; E-Value: 0
Query Start/End: Original strand, 79 - 536
Target Start/End: Complemental strand, 1513956 - 1513494
Alignment:
| Q |
79 |
tagtttgtagtaggtacgggttgtggggttggaaaaccgtaactgtatgacgatcaatttcagttacaatcccggtttgtgttacacactaatttctttt |
178 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||| ||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
1513956 |
tagtttgtagtaggtacgagttgtggggttggaaaaccgttactgtatgacgattaatttcagttataatcccggtttgtgttacacactaatttctttt |
1513857 |
T |
|
| Q |
179 |
gcaatcccgatttcgttcctgcgttgggttcaatgggttgtgcttctggtgtttattctctctatgcatatggtttcattcaactggatttcgatctagt |
278 |
Q |
| |
|
||||||| |||||||||||| ||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
1513856 |
gcaatcctgatttcgttcctccgttgggttcactgggttgtgcttctggtgtttatcctctctatgcatatggtttcattcaactggatttcggtctagt |
1513757 |
T |
|
| Q |
279 |
atgtttttaccacattttgttactactcattataatacccgtttagggatgatgtatacgtgg-----nnnnnnnnnnnnnggttacagatttatacgtg |
373 |
Q |
| |
|
|||||||||||| ||||||||||||||| || ||||||||||||||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
1513756 |
atgtttttaccatattttgttactactcgttgtaatacccgtttagggatgatgtatacgtggttttttttttttttttttggttacagatgtatacgtg |
1513657 |
T |
|
| Q |
374 |
gttgctagtcaggttaatgtcctccaactttttgtttatttaatatattttctttgcttaaaaacaaattgtctagaatctatcagacgggtgggtcaag |
473 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
1513656 |
gttgctagtcaggttaatgtcctccaactttttgtttatttaatatattttctttgcttaaaaacaaattgcctagaatctatcagacgggtgggtcaag |
1513557 |
T |
|
| Q |
474 |
aacccaaatccatttttctttctcattattttggtgagatggaagatttttaggagtattatc |
536 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1513556 |
aacccaaatccatttttctttctcattattttggtgagatggaagatttttaggagtattatc |
1513494 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 37; Significance: 0.00000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 240 - 300
Target Start/End: Complemental strand, 42243516 - 42243456
Alignment:
| Q |
240 |
ctatgcatatggtttcattcaactggatttcgatctagtatgtttttaccacattttgtta |
300 |
Q |
| |
|
|||||||||||||||| || |||||||||||| |||||| ||| ||| ||||||||||||| |
|
|
| T |
42243516 |
ctatgcatatggtttccttaaactggatttcggtctagtgtgtctttgccacattttgtta |
42243456 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 33; Significance: 0.000000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 249 - 305
Target Start/End: Complemental strand, 30827153 - 30827097
Alignment:
| Q |
249 |
tggtttcattcaactggatttcgatctagtatgtttttaccacattttgttactact |
305 |
Q |
| |
|
||||||| || |||||||||||||||||||| || ||||||| ||||||||| |||| |
|
|
| T |
30827153 |
tggtttccttaaactggatttcgatctagtacgtctttaccatattttgttagtact |
30827097 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University