View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12966_high_9 (Length: 208)
Name: NF12966_high_9
Description: NF12966
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12966_high_9 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 100; Significance: 1e-49; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 14 - 191
Target Start/End: Complemental strand, 47687557 - 47687377
Alignment:
| Q |
14 |
tgagaagaacgaaattccatctttatcataatgaaagnnnnnnnnn-ttattgaatatgcaagtaactttatattttataattttttcatatataaatag |
112 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47687557 |
tgagaagaacgaaattccagctttatcataatgaaagaaaaaaaaaattattgaatatgcgagtaactttatattttataattttttcatatataaatag |
47687458 |
T |
 |
| Q |
113 |
ttgnnnnnnnnn--cttcaaacaatggtgggaaacgaaccattttaatatgaggaatagagacatttacgctaaacaaact |
191 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47687457 |
ttgtttttttttttcttcaaacaatggtgggaaacgaaccattttaatatgaggaatagagacatttacgctaaacaaact |
47687377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University