View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12967_high_15 (Length: 238)
Name: NF12967_high_15
Description: NF12967
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12967_high_15 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 194; Significance: 1e-105; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 21 - 222
Target Start/End: Original strand, 4092527 - 4092728
Alignment:
| Q |
21 |
gaggaaaagatagtactgctttatacgatggtttatctaaccttgccgaatttcattttttgacaaaaggataaggttggaatgatgattggttaaatgt |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4092527 |
gaggaaaagatagtactgctttatacgatggtttatctagccttgccgaatttcattttttgacaaaaggataaggttggaatgatgattggttaaatgt |
4092626 |
T |
|
| Q |
121 |
gcactgtgtcatgtttgcatttttcaagggttggtgaaattgttttgtcccaaagatatcatataattacctaggtaggaagtggatggattacgtgctc |
220 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4092627 |
gcaccgtgtcatgtttgcatttttcaagggttggtgaaattgttttgtcccaaagatatcatataattacctaggtaggaagtggatggattacgtgctc |
4092726 |
T |
|
| Q |
221 |
tt |
222 |
Q |
| |
|
|| |
|
|
| T |
4092727 |
tt |
4092728 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 21 - 211
Target Start/End: Original strand, 4082834 - 4083024
Alignment:
| Q |
21 |
gaggaaaagatagtactgctttatacgatggtttatctaaccttgccgaatttcattttttgacaaaaggataaggttggaatgatgattggttaaatgt |
120 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||| || |
|
|
| T |
4082834 |
gaggaaaagatagtactgctttatatgatggtttatctagccttgccgaatttcattttttgacaaaaggataaggatggaatgatgattggttaaaagt |
4082933 |
T |
|
| Q |
121 |
gcactgtgtcatgtttgcatttttcaagggttggtgaaattgttttgtcccaaagatatcatataattacctaggtaggaagtggatggat |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
4082934 |
acactgtgtcatgtttgcatttttcaagggttggtgaaattattttgtcccaaagatatcatataattacctaggtaggaaatggatggat |
4083024 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University