View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12967_high_7 (Length: 400)
Name: NF12967_high_7
Description: NF12967
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12967_high_7 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 288; Significance: 1e-161; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 288; E-Value: 1e-161
Query Start/End: Original strand, 76 - 396
Target Start/End: Complemental strand, 35288924 - 35288604
Alignment:
| Q |
76 |
gaatacaacatatcactcttcttcaatacatagatttgatttactttaggttccttgtcgttaggaaacaaaatcttttagcaccaaaaatatctgaata |
175 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35288924 |
gaatacaacatatcactcttcttcaatatatagatttgatttactttaggttccttgtcgttaggaaacaaaatcttttagcaccaaaaatatctgaata |
35288825 |
T |
 |
| Q |
176 |
aacaatgtttctgttctgctaattttgaaggcttttgcgccgtttgcttttgcattagattgctgcaatgaatgtcatgtggatatggtatttgaaaact |
275 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
35288824 |
aacaatgtttctgttctgctaattttgaaggcttttgcgccgtttgcttttgcattagattgctgcaatggatgtcatgtggatatggtatttgaaaact |
35288725 |
T |
 |
| Q |
276 |
aaacaaaaataaagccgcagaaatggaacaaaccttagcctgaaaaggtaaattaagctgattaaattattaattctacggtatatttttgacatacnnn |
375 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
35288724 |
aaacaaaaataaagccgcagaaatggaacaaaccttagcctgaaaaggtaaattaagctgattaaattattaattctacggtatatttttgacatgcttt |
35288625 |
T |
 |
| Q |
376 |
nnnnggaaaataatgtttgaa |
396 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
35288624 |
ttttggaaaataatgtttgaa |
35288604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 10 - 54
Target Start/End: Complemental strand, 35288959 - 35288915
Alignment:
| Q |
10 |
aaaatatatgactagacgaagttgccactgttttggaatacaaca |
54 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35288959 |
aaaatatatgactagacgaagttgccactgttttggaatacaaca |
35288915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University