View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12967_low_11 (Length: 301)
Name: NF12967_low_11
Description: NF12967
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12967_low_11 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 253; Significance: 1e-141; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 253; E-Value: 1e-141
Query Start/End: Original strand, 23 - 291
Target Start/End: Original strand, 22329840 - 22330108
Alignment:
| Q |
23 |
aggtcttaatttaactgctttctactccaacaagtgtttttgcttccttgtcatggaaaaacaattggtagtaaaatctttatgatcatatcatatcata |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22329840 |
aggtcttaatttaactgctttctactccaacaagtttttttgcttccttgtcatggaaaaacaattggtagtaaaatctttatgatcatatcatatcata |
22329939 |
T |
 |
| Q |
123 |
tcaatctctttcgtgcttgaatttttggtagcatttgactgagaagtcattgtccatgaacaatagaaactgttgacgaaagaaacaggttgtgtattgt |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
22329940 |
tcaatctctttcgtgcttgaatttttggtagcatttgactgagaagtcattgtccatgaacaatagaaactgttgatgaaagaaacaggttgtgtattgt |
22330039 |
T |
 |
| Q |
223 |
atgagagttgattccgaccttggtaaaagggaagtatcctagattcattacggtttgttttctcctttg |
291 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||| |
|
|
| T |
22330040 |
atgagagttgattccgaccttggtaaaagggaagtatcctagattcattatggtttgtttgctcctttg |
22330108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University