View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12967_low_12 (Length: 276)
Name: NF12967_low_12
Description: NF12967
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12967_low_12 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 242; Significance: 1e-134; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 2 - 266
Target Start/End: Complemental strand, 4082645 - 4082378
Alignment:
| Q |
2 |
ggaagccggagccggaagaaactttcaaatttcaatggctgttgtccagactcttgaagaccctcatgttgagatgagggagtgttttcagatctttgaa |
101 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
4082645 |
ggaagccggagtcggaagaaactttcaaatttcaatggctgttgtccagactcttgaagaccctcatgttgagatgagggagcgttttcagatctttgaa |
4082546 |
T |
|
| Q |
102 |
tctatctgtgtgagagttgttatggcatttggtgctctactctgttctcaacttgacaaagatgttttgcgatacctgaacgag---acaagtgttaaac |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
4082545 |
tctatctgtgtgagagttgttatggcatttggtgctctactctgttctcaacttgacaaagatgttttgcgatacctgaacgagcacacaagtgttaaac |
4082446 |
T |
|
| Q |
199 |
acactgtgatatcagctgttgcagtcattcacgtgacctttcttttcttcactctctttgcctctctg |
266 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4082445 |
acactgtgatatcagttgttgcagtcattcacgtgacctttcttttcttcactctctttgcctctctg |
4082378 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 2 - 266
Target Start/End: Complemental strand, 4092354 - 4092087
Alignment:
| Q |
2 |
ggaagccggagccggaagaaactttcaaatttcaatggctgttgtccagactcttgaagaccctcatgttgagatgagggagtgttttcagatctttgaa |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
4092354 |
ggaagccggagccggaagaaactttcaaatttcaatggatgttgtccagactcttgaagaccctcatgttgagatgagggagcgttttaagatctttgaa |
4092255 |
T |
|
| Q |
102 |
tctatctgtgtgagagttgttatggcatttggtgctctactctgttctcaacttgacaaagatgttttgcgatacctgaacgag---acaagtgttaaac |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || | ||||||||||| |
|
|
| T |
4092254 |
tctatctgtgtgagagttgttatggcatttggtgctctactctgttctcaacttgacaaagatgttttgcgatacctgaactagcacataagtgttaaac |
4092155 |
T |
|
| Q |
199 |
acactgtgatatcagctgttgcagtcattcacgtgacctttcttttcttcactctctttgcctctctg |
266 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4092154 |
aaactgtgatatcagctgttgcagtcattcacgtgacctttcttttcttcactctctttgcctctctg |
4092087 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 188 - 266
Target Start/End: Complemental strand, 4086605 - 4086527
Alignment:
| Q |
188 |
aagtgttaaacacactgtgatatcagctgttgcagtcattcacgtgacctttcttttcttcactctctttgcctctctg |
266 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4086605 |
aagtgttaaacacactgtgatatcagttgttgcagtcattcacgtgacctttcttttcttcactctctttgcctctctg |
4086527 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University