View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12967_low_16 (Length: 244)
Name: NF12967_low_16
Description: NF12967
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12967_low_16 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 19 - 230
Target Start/End: Original strand, 40015922 - 40016134
Alignment:
| Q |
19 |
atataatgtgattattttgtatgtagatctttagatctttctataacttcaatttttcatcttatcagataaatggtatattcagaagagnnnnnnntta |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
40015922 |
atataatgtgattattttgtatgtagatctttagatctttctataacttcaatttttcatcttatcagataaatggtatattcagaagagaaaaaaatta |
40016021 |
T |
|
| Q |
119 |
gtaatttgcacataggtttatgtttctggacaannnnnnnctt-tctttcaaaaaagtcttagaattagatgtgtttaattaataaaaaaggaagattaa |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||| || || | ||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
40016022 |
gtaatttgcacataggtttatgtttctggataattttttttttctttttcaaaaaagtcttagaattagatgtgtttaattaataaaaaaggaagatcaa |
40016121 |
T |
|
| Q |
218 |
ttcgtagtattat |
230 |
Q |
| |
|
||||||||||||| |
|
|
| T |
40016122 |
ttcgtagtattat |
40016134 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University