View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12968_high_13 (Length: 394)
Name: NF12968_high_13
Description: NF12968
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12968_high_13 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 339; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 339; E-Value: 0
Query Start/End: Original strand, 18 - 376
Target Start/End: Original strand, 13792858 - 13793216
Alignment:
| Q |
18 |
aataaaaggttgttacagatttttctaaggtctttccagcgttgagagataggtataaatggtaaactgtagttatggtggtttgcacctttcattgcat |
117 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||| |
|
|
| T |
13792858 |
aataaaaggttgttacatatttttctaaggtctttccagcgttgagagataggtataaatggtaaactgtaattatggtggttagcacctttcattgcat |
13792957 |
T |
|
| Q |
118 |
cggggattgttctattagagagagattggtcgttgatttgaaggactgatttgacggtttctgtggaggacataactatggtagttattcggcccaattt |
217 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13792958 |
cggggattgttctattagagagagaatggtcgttgatttgaaggactgatttgacagtttctgtggaggacataactatggtagttattcggcccaattt |
13793057 |
T |
|
| Q |
218 |
taaggacattattgggccgtggattttggagagttttgcgagggtttggtggggcttttgacccagttgatggagattgcctatgatggggaggccacgt |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13793058 |
taaggacattattgggccgtggattttggagagttttgcgagggtttggtggggcttttgacccagttgatggagattgcctatgatggggaggccacgt |
13793157 |
T |
|
| Q |
318 |
ggacccggtggaagtcgaggtttgtgttttatgagaaaggaatagaggatttggaggaa |
376 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13793158 |
ggacccggtggaagtcgaggtttgtgttttatgagaaaggaatagaggatttggaggaa |
13793216 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University