View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12968_high_15 (Length: 389)
Name: NF12968_high_15
Description: NF12968
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12968_high_15 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 329; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 329; E-Value: 0
Query Start/End: Original strand, 52 - 380
Target Start/End: Original strand, 37288776 - 37289104
Alignment:
| Q |
52 |
tatgcaaaaatgagttgttacctttgtttgtgactttgtgctgatgttgaaaaggttgtacttgacaggtgttgagttctgatgttggtttaaggtagaa |
151 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37288776 |
tatgcaaaaatgagttgttacctttgtttgtgactttgtgctgatgttgaaaaggttgtacttgacaggtgttgagttctgatgttggtttaaggtagaa |
37288875 |
T |
 |
| Q |
152 |
caaaaattgcaggatttcagaggtttttctgaaaaatggaggtgttaggagtaaagggttttgtcctcttgtttttctgtttgtggattccaaatgaagt |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37288876 |
caaaaattgcaggatttcagaggtttttctgaaaaatggaggtgttaggagtaaagggttttgtcctcttgtttttctgtttgtggattccaaatgaagt |
37288975 |
T |
 |
| Q |
252 |
tgtggctatcattggaaactctactgtttcttctagaccaactgttgtgaaaattggagcactgtttactgttgattctgtgattggaagatcagctcaa |
351 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37288976 |
tgtggctatcattggaaactctactgtttcttctagaccaactgttgtgaaaattggagcactgtttactgttgattctgtgattggaagatcagctcaa |
37289075 |
T |
 |
| Q |
352 |
caaggaatcaaaactgcaattgatgatgt |
380 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
37289076 |
caaggaatcaaaactgcaattgatgatgt |
37289104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University