View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12968_high_23 (Length: 328)
Name: NF12968_high_23
Description: NF12968
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12968_high_23 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 14 - 312
Target Start/End: Original strand, 44393482 - 44393799
Alignment:
| Q |
14 |
agactatagaggattgaatatgaacatgaaaattcacataagcaatta---cttttggtgttaattaaagatg---atgtataggctatagctatagcta |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
44393482 |
agactatagaggattgaatatgaacatgaaaattcacataagcaattattacttttggtgttaattaaagatgatgatgtataggctatagctatagcta |
44393581 |
T |
|
| Q |
108 |
tatgatcataattcatcagttggtaacaacagcaggcatcac-----atgggcatcacttgcgtagataataagttcctcatattctgctgccagccagc |
202 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44393582 |
tatgatcatcattcatcagttggtaacaacagcaggcatcacatgggatgggcatcacttgcgtagataataagttcctcatattctgctgccagccagc |
44393681 |
T |
|
| Q |
203 |
caggt----gtgatcttcattattttgattcctttttcttcttttggaaaaataaatacgtgtgtctctctaaggttaaggcc----atatgtggattct |
294 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
44393682 |
caggtgtgagtgatcttcataattttgattcctttttcttcttttggcaaaataaatacgtgtgtctctctaaggttaaggccatatatatgtggattct |
44393781 |
T |
|
| Q |
295 |
atttcatattggtgaaat |
312 |
Q |
| |
|
|||||||||| ||||||| |
|
|
| T |
44393782 |
atttcatatttgtgaaat |
44393799 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University