View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12968_high_33 (Length: 251)
Name: NF12968_high_33
Description: NF12968
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12968_high_33 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 175; Significance: 3e-94; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 13 - 251
Target Start/End: Complemental strand, 43870044 - 43869804
Alignment:
| Q |
13 |
aatatcgatccctggttcattctttgaaaattcagttgaattttatnnnnnnnnnngtgattattttacaaggctagtaaatttatcagtacgtagaaca |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43870044 |
aatatcgatccctggttcattctttgaaaattcagttgaattttataaaaaaaa--gtgattattttacaaggctagtaaatttatcagtacgtagaaca |
43869947 |
T |
|
| Q |
113 |
caaacttaccaggaaa----aatatgttcaaactttaaaacatgtcaaaaatagcattttctggaatattagctttttctacccattgttataattagtt |
208 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||| |
|
|
| T |
43869946 |
caaacttaccaggaaattaaaatatgttcaaactttaaaacatgtcaaaaatagcattttctataatggtagctttttctacccattgttataattagtt |
43869847 |
T |
|
| Q |
209 |
gaataccgtttaaccttatctttggtatcacacacagtgaaga |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43869846 |
gaataccgtttaaccttatctttggtatcacacacagtgaaga |
43869804 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University