View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12968_high_38 (Length: 236)
Name: NF12968_high_38
Description: NF12968
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12968_high_38 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 1 - 216
Target Start/End: Original strand, 2125900 - 2126116
Alignment:
| Q |
1 |
tccaaaccatcaccatgttgtaattatgggagtgtagtaactaggtcattatatcattaacagatttatggggtggttggnnnnnnnnn-cataaacaca |
99 |
Q |
| |
|
||||||||||||||||||| ||||||| ||||||||| ||||||||||||||| |||||||| ||||||||||||||||| |||||||||| |
|
|
| T |
2125900 |
tccaaaccatcaccatgttataattattggagtgtagaaactaggtcattataacattaacacatttatggggtggttggaaaaaaaaaacataaacaca |
2125999 |
T |
 |
| Q |
100 |
tgtaaaacattgcttgtagtatcttatttcaatccatcaatttatctatatccttttgttgttgtgttttacttacaagaacttttattttggtgttatg |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2126000 |
tgtaaaacattgcttgtagtatcttatttcaatccatcaatttatctatatccttttgttgttgtgttttacttacaagaacttttattttggtgttatg |
2126099 |
T |
 |
| Q |
200 |
ttagtctgtatgttgtc |
216 |
Q |
| |
|
|||||||| |||||||| |
|
|
| T |
2126100 |
ttagtctgcatgttgtc |
2126116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University