View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12968_low_30 (Length: 306)
Name: NF12968_low_30
Description: NF12968
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12968_low_30 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 216; Significance: 1e-118; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 30 - 306
Target Start/End: Complemental strand, 18993844 - 18993568
Alignment:
| Q |
30 |
ccaccatgcaccatgatatcctccatacacacatcctcacccgcctcgacgcctcgacgctggccaccaccgcctccacttgctctcacctccgccacct |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||| | ||||| |||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
18993844 |
ccaccatgcaccatgatatcctccatacacacatcctcacccacctcgacgccgccacgctcgccaccactgcctccacttgctctcacctccgccacct |
18993745 |
T |
|
| Q |
130 |
ctgcatggataatgatctatggnnnnnnntctgcaccgagacgtggccgtcgttactagattctaccaccagccatgtcatctccactttcccaaatggt |
229 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18993744 |
ctgcatggataatgatctttggaaaaaaatctgcaccgagacgtggccgtcgttactagattctaccaccagccatgtcatctccactttcccaaatggt |
18993645 |
T |
|
| Q |
230 |
caccgttcgattttctcagacgcatttcccactcatcctcatctctcttctcattcaaaatcaaatcattctccgtc |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| || |||| |||||||||||||||||||||||||| ||||||| |
|
|
| T |
18993644 |
caccgttcgattttctcagacgcatttcccactcttcatcatttctcttctcattcaaaatcaaatcatcctccgtc |
18993568 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University