View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12968_low_36 (Length: 261)
Name: NF12968_low_36
Description: NF12968
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12968_low_36 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 20 - 244
Target Start/End: Complemental strand, 30242655 - 30242431
Alignment:
| Q |
20 |
aggatgaggatgaagaggttttgcgtgattcgaagtcacgcaacnnnnnnnnnnnntttaaagtaaagtggagacttgtttttgaatggatactatttct |
119 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
30242655 |
aggatgaggacgaagaggttttgcgtgattcgaagtcacacaacaaaaagaaaaaatttaaagtaaagtggagacttgtttttgaatggatattatttct |
30242556 |
T |
 |
| Q |
120 |
aaacatattaacatgtttggtttgttctgtcacaataagaggaataacaaacatgcatttattagggttagaggtttggagatggtgtttaatggcaatg |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30242555 |
aaacatattaacatgtttggtttgttctgtcacaataagaggaataacaaacatgcatttattagggttagaggtttggagatggtgtttaatggcaatg |
30242456 |
T |
 |
| Q |
220 |
gtaacatttagtggccgtttgtttt |
244 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
30242455 |
gtaacatttagtggccgtttgtttt |
30242431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University