View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12968_low_37 (Length: 253)
Name: NF12968_low_37
Description: NF12968
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12968_low_37 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 30 - 235
Target Start/End: Original strand, 3685664 - 3685869
Alignment:
| Q |
30 |
agaaaccaggcaagcaaaagataaccctgcatgcataggtttttcgaaagcaattaagacaccatttgctcgaaatgttcacctccagtcaatgaacata |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3685664 |
agaaaccaggcaagcaaaagataaccctgcatgcataggtttttcgaaagcaattaagacaccatttgctcgaaatgttcacctccagtcaatgaacata |
3685763 |
T |
 |
| Q |
130 |
tagttgtgcaatctgaattaacagtaacaggtgatgctcagccacgtactgatgaagcataactagcaatataagatgagcaaccaagcatgaaaggttg |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3685764 |
tagttgtgcaatctgaattaacagtaacaggtgattttcaaccacgtactgatgaagcacgactagcaatataagatgagcaaccaagcatgaaaggttg |
3685863 |
T |
 |
| Q |
230 |
tgtaac |
235 |
Q |
| |
|
||||| |
|
|
| T |
3685864 |
cgtaac |
3685869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University