View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12968_low_45 (Length: 236)
Name: NF12968_low_45
Description: NF12968
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12968_low_45 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 22 - 230
Target Start/End: Complemental strand, 37289645 - 37289437
Alignment:
| Q |
22 |
ttaatgaagcttgttcacttctttctctaacacagagacttgcaaatagggtgccataagaaattcttctctaaattatatcatatataagaggaagatt |
121 |
Q |
| |
|
|||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
37289645 |
ttaatgaagcttgttcacttctttttcaaacacagagacttgcaaatagggtgccataagaaattcttctctaaat-atatcctatataagaggaagatt |
37289547 |
T |
 |
| Q |
122 |
atatacttactagtcttatactagaaatggatggtggttaatgagttctaattaagttctaattgaac-gggagtactcgagctcgagccctaactgaaa |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
37289546 |
atatacttactagtcttatactagaaatggatggtggttaatgagttctagttaagttctaattgaacggggagtactcgagttcgagccctaactgaaa |
37289447 |
T |
 |
| Q |
221 |
caatcattgg |
230 |
Q |
| |
|
|||||||||| |
|
|
| T |
37289446 |
caatcattgg |
37289437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University