View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12968_low_47 (Length: 228)
Name: NF12968_low_47
Description: NF12968
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12968_low_47 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 44; Significance: 3e-16; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 16 - 59
Target Start/End: Original strand, 27748786 - 27748829
Alignment:
| Q |
16 |
aaaataattgatagaaaagttagtaaatttatatattgacttct |
59 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27748786 |
aaaataattgatagaaaagttagtaaatttatatattgacttct |
27748829 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University