View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12968_low_51 (Length: 205)
Name: NF12968_low_51
Description: NF12968
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12968_low_51 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 104; Significance: 5e-52; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 104; E-Value: 5e-52
Query Start/End: Original strand, 18 - 125
Target Start/End: Original strand, 1591141 - 1591248
Alignment:
| Q |
18 |
ctggtgacccaactgtttccacagaacttcacgtctcttccaccactgcttctcctcttggtgttcctcaaaaggttccttctttgctcttctgattcca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1591141 |
ctggtgacccaactgtttccacagaacttcacgtctcttccaccactgtttctcctcttggtgttcctcaaaaggttccttctttgctcttctgattcca |
1591240 |
T |
 |
| Q |
118 |
tttcgttc |
125 |
Q |
| |
|
|||||||| |
|
|
| T |
1591241 |
tttcgttc |
1591248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University