View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12968_low_52 (Length: 203)
Name: NF12968_low_52
Description: NF12968
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12968_low_52 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 18 - 187
Target Start/End: Original strand, 42661864 - 42662033
Alignment:
| Q |
18 |
aataccatcatccaaggtcctagcacaatcaggaataacagcagcaagtgactgaaattttggaaatttcaagttgacatcaggtgctacttcagctaag |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42661864 |
aataccatcatccaaggtcctagcacaatcaggaataacagcagcaagtgactgaaattttggaaatttcaagttgacatcaggtgctacttcagctaag |
42661963 |
T |
|
| Q |
118 |
taactatccatcaaatcagcaacttttgtcattggagtagcacgttgacaatttgcaccaatgcgtctct |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||| |
|
|
| T |
42661964 |
taactatccatcaaatcagcaacttttgtcattggagtagcacgttgacaatttccaacaatgcgtctct |
42662033 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University