View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12969_high_5 (Length: 245)
Name: NF12969_high_5
Description: NF12969
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12969_high_5 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 164; Significance: 9e-88; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 19 - 226
Target Start/End: Original strand, 35681089 - 35681296
Alignment:
| Q |
19 |
tgatttcccaaacaaaattattttcatctataaggcagccaaataccgcaacagcaacagcaataaactacttgaaaatatttcttgcaaacatttgccg |
118 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35681089 |
tgatttcccaaacaaaattattttcacctataaggcagccaaataccgcaacagcaacagcaataaactacttgaaaatatttcttgcaaacatttgccg |
35681188 |
T |
 |
| Q |
119 |
actagaaagaatacttaacaataaaatctcaactccnnnnnnnnctctcgtagatttttccgagaaaagtaatcatattcgagatagtatcaaacactaa |
218 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||| | ||||||| |||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
35681189 |
actagaaaaaatacttaacaataaaatctcaactacttttttttctctcgtggatttttccgagaaaagtaatcatattcgagatagtgtcaaacactaa |
35681288 |
T |
 |
| Q |
219 |
atgcgatc |
226 |
Q |
| |
|
|||||||| |
|
|
| T |
35681289 |
atgcgatc |
35681296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University