View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12969_low_4 (Length: 272)
Name: NF12969_low_4
Description: NF12969
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12969_low_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 18 - 263
Target Start/End: Complemental strand, 35680929 - 35680681
Alignment:
| Q |
18 |
agaaatcaaagggggattcatggccaaaattagccagaagattggtacagtttccttatcataatgtttgcctaaactagatacagacatttcacaaacc |
117 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
35680929 |
agaaatcaaaggtggattcatggccaaaattagccagaagattggtacagtttccttatcataatgtttgcctaaattagatacagacatttcacaaacc |
35680830 |
T |
 |
| Q |
118 |
atgaaggacaaa-ctagcaagtatcagggcacccgatcttgacaaggttaacaacaaacaatagtgtattcttggttacaatattttgaagaaaaaattg |
216 |
Q |
| |
|
|||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35680829 |
atgaaggacaaaactagcaggtatcagggcacccgatcttgacaaggttaacaacaaacaatagtgtattcttggttacaatattttgaagaaaaaattg |
35680730 |
T |
 |
| Q |
217 |
tttttagagatgtataattgatttta--atgtttgattatttaagtatt |
263 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
35680729 |
tttttagagatgtataattgattttaatatgtttgattatttaagtatt |
35680681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 210 - 243
Target Start/End: Complemental strand, 47179609 - 47179576
Alignment:
| Q |
210 |
aaaattgtttttagagatgtataattgattttaa |
243 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| |
|
|
| T |
47179609 |
aaaattgattttagagatgtataattgattttaa |
47179576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University